View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1986_high_8 (Length: 232)
Name: NF1986_high_8
Description: NF1986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1986_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 28495281 - 28495497
Alignment:
| Q |
1 |
tatcaatactagtattgctgctagttgaacccatttgagctgctttttgcagaagagcagtagctgacattggtgtagcagaaacagtaacagaaccgga |
100 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28495281 |
tatcattactagtattgcttctagttgaacccatttgagctgctttttgcagaagagcagtagctgacattggtgtagcagaaacagtaacagaaccgga |
28495380 |
T |
|
| Q |
101 |
agaagcaggttttgatagagaaagatttgcagcagatgttgaatttgaagcaggtataccaaatattgatgatgaagaagaacaaatcaaggcattatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28495381 |
agaagcaggttttgatagagaaagatttgcagcagatgttgaatttgaagcaggtataccaaacattgatgatgaagaagaacaaatcaaggcattatta |
28495480 |
T |
|
| Q |
201 |
ttattattagtagtagc |
217 |
Q |
| |
|
||||||||| ||||||| |
|
|
| T |
28495481 |
ttattattattagtagc |
28495497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 73
Target Start/End: Complemental strand, 40750216 - 40750153
Alignment:
| Q |
10 |
tagtattgctgctagttgaacccatttgagctgctttttgcagaagagcagtagctgacattgg |
73 |
Q |
| |
|
||||| |||| || |||||||| |||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
40750216 |
tagtactgcttcttgttgaacctatttgagctgctttctgaagaagtgcagtagctgacattgg |
40750153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University