View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1986_low_2 (Length: 419)
Name: NF1986_low_2
Description: NF1986
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1986_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 13 - 158
Target Start/End: Complemental strand, 32747291 - 32747152
Alignment:
| Q |
13 |
aatatgccaaactaaggtcattcctaacttagactgaccactgtccccataccgtgaaaaatagccaccatactcaccactaccagctcctctggagtag |
112 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32747291 |
aatatgccaaactaaggccattcctaacttagactgaccactgtccccataccgtgaaaaatagccaccatactc------accagctcctctggagtag |
32747198 |
T |
 |
| Q |
113 |
caaaaacccaccctagaaaatttcaagaactagattagtgattcac |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32747197 |
caaaaacccaccctagaaaatttcaagaactagattagtgattcac |
32747152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 352 - 419
Target Start/End: Complemental strand, 32747063 - 32746996
Alignment:
| Q |
352 |
aagcattaagtagcactgaaaacaaaaaatattggcagatctctgtgaaatgaagaatttacaggaac |
419 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32747063 |
aagcattaagtagcactgaaaacaaaaaatattggcaggtctctgtgaaatgaagaatttacaggaac |
32746996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University