View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19870_low_2 (Length: 255)
Name: NF19870_low_2
Description: NF19870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19870_low_2 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 23 - 255
Target Start/End: Original strand, 5526879 - 5527111
Alignment:
| Q |
23 |
tagtgattttagtgcatgttcactagatttgctaaaataatgaagatcatagtgatttcagcaaatccaccatcaataatctggaaaatgtaaatattta |
122 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5526879 |
tagtaattttagtgcatgttcactagatttgctaaaataacgaagatcatagtgatttcagcaaatccaccatcaataatctggaaaatgtaaatattta |
5526978 |
T |
 |
| Q |
123 |
taattcattatatttcgttgtttcacattgattatctatacttttcgagttgtctacttgagagatagtcactttggtaaaaaagaaataaaacaagttt |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
5526979 |
taattcattagatttcgttgtttcacattcattatctatactttccgagttgtctacttgagagatagccactttgataaaaaagaaataaaacaagttt |
5527078 |
T |
 |
| Q |
223 |
ttataataaaagatacatatgttttgttgccga |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5527079 |
ttataataaaagatacatatgttttgttgccga |
5527111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University