View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19870_low_3 (Length: 232)

Name: NF19870_low_3
Description: NF19870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19870_low_3
NF19870_low_3
[»] chr5 (3 HSPs)
chr5 (141-217)||(8545959-8546035)
chr5 (68-123)||(8545851-8545906)
chr5 (16-49)||(8545817-8545850)


Alignment Details
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 141 - 217
Target Start/End: Original strand, 8545959 - 8546035
Alignment:
141 atatgagaatatatgttcgaaattgaatttgtgttgcatctatttaaaatgcgtgggagattgcatgattatatggt 217  Q
    ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8545959 atatgagaaaatatgttcaaaattgaatttgtgttgcatctatttaaaatgcgtgggagattgcatgattatatggt 8546035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 68 - 123
Target Start/End: Original strand, 8545851 - 8545906
Alignment:
68 atttagtttagttctgtttctgcagcgaataattcatgtgattggaatttttcaag 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8545851 atttagtttagttctgtttctgcagcgaataattcatgtgattggaatttttcaag 8545906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 49
Target Start/End: Original strand, 8545817 - 8545850
Alignment:
16 atgaagaaggataactgttgatacatgataggga 49  Q
    |||||||||||||||||||||||||| |||||||    
8545817 atgaagaaggataactgttgatacataataggga 8545850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University