View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19870_low_3 (Length: 232)
Name: NF19870_low_3
Description: NF19870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19870_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 69; Significance: 4e-31; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 141 - 217
Target Start/End: Original strand, 8545959 - 8546035
Alignment:
| Q |
141 |
atatgagaatatatgttcgaaattgaatttgtgttgcatctatttaaaatgcgtgggagattgcatgattatatggt |
217 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8545959 |
atatgagaaaatatgttcaaaattgaatttgtgttgcatctatttaaaatgcgtgggagattgcatgattatatggt |
8546035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 68 - 123
Target Start/End: Original strand, 8545851 - 8545906
Alignment:
| Q |
68 |
atttagtttagttctgtttctgcagcgaataattcatgtgattggaatttttcaag |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8545851 |
atttagtttagttctgtttctgcagcgaataattcatgtgattggaatttttcaag |
8545906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 49
Target Start/End: Original strand, 8545817 - 8545850
Alignment:
| Q |
16 |
atgaagaaggataactgttgatacatgataggga |
49 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
8545817 |
atgaagaaggataactgttgatacataataggga |
8545850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University