View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19872_high_18 (Length: 247)

Name: NF19872_high_18
Description: NF19872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19872_high_18
NF19872_high_18
[»] chr8 (1 HSPs)
chr8 (41-79)||(8734557-8734595)


Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 41 - 79
Target Start/End: Complemental strand, 8734595 - 8734557
Alignment:
41 cctatgtttgttgctataatcttagtgtaataagtatga 79  Q
    |||||||||||||||||||||||||||| ||||||||||    
8734595 cctatgtttgttgctataatcttagtgtcataagtatga 8734557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University