View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19872_high_19 (Length: 237)
Name: NF19872_high_19
Description: NF19872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19872_high_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 223
Target Start/End: Original strand, 44727277 - 44727479
Alignment:
| Q |
18 |
agaagaacatttgtttgctaaatgtggtttttcgggcactgtttggtatgtggtattcaagtggcttggcttcaactcggttttgtcggggaatttgttt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44727277 |
agaagaacatttgtttgctaaatgtggtttttcgggcactgtttggtatgtggtattcaagtggcttggcttcaactcggttttgtcggggaatttgttt |
44727376 |
T |
|
| Q |
118 |
attttgctccaaacttttacttcgtttgaaaagctaggaactagaaatcttcataaattttcgcttcacgttaaaattttagttgaaataattcaataat |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
44727377 |
attttgctccaaacttttatttcgtttgaaaagctaggaactagaaatcttcataaattttgcaatta---taaaattttagttgaaataattcaataat |
44727473 |
T |
|
| Q |
218 |
tcatct |
223 |
Q |
| |
|
|||||| |
|
|
| T |
44727474 |
tcatct |
44727479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University