View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19872_high_21 (Length: 219)
Name: NF19872_high_21
Description: NF19872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19872_high_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 18 - 205
Target Start/End: Original strand, 34131776 - 34131971
Alignment:
| Q |
18 |
caaataagtaataataaagaatgatccaaagtatttaaggtagactctcacattatcataaaatttagattgggtctaactcaaa--------ttcaact |
109 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
34131776 |
caaataagtaataacaaagaatgatccaaagtatttaaggtagactctcacattatcataaaatttagattgagtctaactcaaatccacaaattcaact |
34131875 |
T |
 |
| Q |
110 |
tagacggtgtcggatactcaccacttatgaacaaattttgggtctataacgtccaatctgttaacttctatctaattcatacataactgtcatatt |
205 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34131876 |
tagacggtgttgaatactcaccacttatgaacaaattttgggtctatcacgtccaatctgttaacttctatctaattcatacataactgtcatatt |
34131971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University