View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19872_low_26 (Length: 204)
Name: NF19872_low_26
Description: NF19872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19872_low_26 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 35 - 204
Target Start/End: Original strand, 44727478 - 44727647
Alignment:
| Q |
35 |
cttttttgaatgttgtcttttggtttatggcccgacctagaaactacatagaccatcaccaggtgatgggatatatgctccgcaatattccttttgcaac |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44727478 |
cttttttgaatgttgtcttttggtttatggcccgacctagaaactacatagaccatcaccaggtgatgggatatatgctccacaatattccttttgcaac |
44727577 |
T |
 |
| Q |
135 |
tgcaaaatgccaatccctagaaactactaatgtttccttgaggtttcagcataggctagatatccaaaac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
44727578 |
tgcaaaatgccaatccctagaaactactaatgtttccttgaggtttcagcatagcctggatatccaaaac |
44727647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University