View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19873_low_3 (Length: 476)
Name: NF19873_low_3
Description: NF19873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19873_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 124 - 458
Target Start/End: Original strand, 22250935 - 22251269
Alignment:
| Q |
124 |
acaagcagcactgaaatttttgatgataaaacctcacatgcaaaaagaaaaatatacataaagaatatttagaactggcaaagaatatttatgtaacaag |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22250935 |
acaagcagcactgaaatttttgatgataaaacctcacatgcaaaaataaaaatatacataaagaatatttagaactggcaaagaatatttatgtaataag |
22251034 |
T |
|
| Q |
224 |
gagtgtaaccgagaaaattaaaacgtcaattatttctgggttacacttcatgttacataaatattctctgtcaattctgaatcttcggcttgcctgttag |
323 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| |||||||||| ||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
22251035 |
gagtgtaactgagaaaattaacacgtcaattatttctaagttacacttcctgttacataaatattttctgtcaattctgaatcttcagcttgcctgttag |
22251134 |
T |
|
| Q |
324 |
cattcacatgtctattgtctcattgtttttattttgcaggtcttcatagcatttcatcaacatggagtaccaccgaagaaacctaggtttgatccaaccc |
423 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22251135 |
cgttcacatgtctattgtctcattgtttttattttgcaggtcttcacagcatttcatcaacatgcagtaccatcgaagaaacctaggtttgatccaaccc |
22251234 |
T |
|
| Q |
424 |
aaggaaaaagacccgagttctgttttgatgatgct |
458 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
22251235 |
aaggaaaaagacccgaattctgttttgatgatgct |
22251269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 336 - 456
Target Start/End: Original strand, 22204238 - 22204359
Alignment:
| Q |
336 |
tattgtctcattgtttttattttgcaggtcttcatagcattt-catcaacatggagtaccaccgaagaaacctaggtttgatccaacccaaggaaaaaga |
434 |
Q |
| |
|
|||| ||||||||||||| |||||| ||| ||| |||||||| |||| ||||| |||||||| || ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
22204238 |
tattatctcattgtttttgttttgcgggttttcgtagcattttcatcgacatgcagtaccactgaggaaacctgggtgtgatccaacccaaggaaaaaga |
22204337 |
T |
|
| Q |
435 |
cccgagttctgttttgatgatg |
456 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
22204338 |
cccgagttcgattttgatgatg |
22204359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 336 - 456
Target Start/End: Complemental strand, 22230501 - 22230380
Alignment:
| Q |
336 |
tattgtctcattgtttttattttgcaggtcttcatagcattt-catcaacatggagtaccaccgaagaaacctaggtttgatccaacccaaggaaaaaga |
434 |
Q |
| |
|
|||| ||||||||||||| |||||| ||| ||| |||||||| |||| ||||| |||||||| || ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
22230501 |
tattatctcattgtttttgttttgcgggttttcgtagcattttcatcgacatgcagtaccactgaggaaacctgggtgtgatccaacccaaggaaaaaga |
22230402 |
T |
|
| Q |
435 |
cccgagttctgttttgatgatg |
456 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
22230401 |
cccgagttcgattttgatgatg |
22230380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 386 - 456
Target Start/End: Complemental strand, 22551654 - 22551584
Alignment:
| Q |
386 |
tggagtaccaccgaagaaacctaggtttgatccaacccaaggaaaaagacccgagttctgttttgatgatg |
456 |
Q |
| |
|
||||||||||| | ||||||| | || |||||||| |||||||||||||||||||||| |||||| |||| |
|
|
| T |
22551654 |
tggagtaccactaatgaaacctggattcgatccaactcaaggaaaaagacccgagttctattttgaagatg |
22551584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University