View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19874_high_11 (Length: 415)
Name: NF19874_high_11
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19874_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 398
Target Start/End: Complemental strand, 36377067 - 36376684
Alignment:
| Q |
1 |
taactccattgacaaatcagccctttataggatccagtaattcgtaattaaagcttgcatcagnnnnnnnnn--gacagtaa-gcttccatcactttcaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
36377067 |
taactccattgacaaatcagccctttataggatccagtaattcgtaattaaagcttgcatcagtttttttttttgacagtaaagcttccatcactttcaa |
36376968 |
T |
 |
| Q |
98 |
aacaaattccctgcttttaataatttttgcaatacgagaccaatctaaatgttgagcgtgttttaataatataacccatttctctctcataaagacactg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36376967 |
aacaaattccctgcttttaataatttttgcaatacgagaccaatctaaatgttgagcgtgttttaataatataacccatttctctctcataaagacactg |
36376868 |
T |
 |
| Q |
198 |
cttcagtgcttctgctgtaactattgttttcagtttttcttgtctctccnnnnnnngaagaaataatatctgttttacaatgccgacgcggtggagtaga |
297 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36376867 |
cttcagtgcttctgctgtaactattg-tttcggtttttcttgtttctccaaaaaaagaagaaataatatctgttttacaatgccgacacggtggagtaga |
36376769 |
T |
 |
| Q |
298 |
aacaaaaacaatggtgataataagaaccaggatggttgtgcgacaggatggttgcgtcgggattggcggtgtgggtggaggcgagggtgccggtggctag |
397 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36376768 |
aacaaaaacaatggtgataataagaac----------------caggatggttgcgtcgggattggcggtgtgggtggaggcgagggtgccggtggctag |
36376685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University