View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19874_high_24 (Length: 275)

Name: NF19874_high_24
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19874_high_24
NF19874_high_24
[»] chr1 (1 HSPs)
chr1 (1-269)||(26528125-26528393)


Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 26528393 - 26528125
Alignment:
1 tctttccacaattccattttcttgcatacccttttcattacaatgtccatatcttgtgaaaaattaagttctttctcttcctccttaatgagatcataaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26528393 tctttccacaattccattttcttgcatacccttttcattacaatgtccatatcttgtgaaaaattaagttctttctcttcctccttaatgagatcataaa 26528294  T
101 ctagtctcttgagaactttttggtcttgccatctttcatgaacacttggatggcaaaggatttcatgaactatttctctcaatgccttctcttcatttga 200  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
26528293 ctagtctcttgaaaactttttggtcttgccatctttcatgaacacttggatggcaaaggatttcatgaactatttctctcaatgccttctcttcacttga 26528194  T
201 tgcttcaatttcatcttcttcataatcatcgtcttcgaatgctttgttgtcttcttgcattcttctctc 269  Q
    ||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||    
26528193 tgcttcactttcatcttcttcataatcatcgtcttcgaatgcttcgttgtcttcttgcattcttttctc 26528125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University