View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19874_high_26 (Length: 269)
Name: NF19874_high_26
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19874_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 80 - 140
Target Start/End: Original strand, 16268278 - 16268338
Alignment:
| Q |
80 |
ccacattatttgaaacatattaaatcacaaatttttgttcataaatactcttttcgatctt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
16268278 |
ccacattatttgaaacatattaaatcacaattttttgttcataaatactctcttcgatctt |
16268338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 26 - 64
Target Start/End: Original strand, 16268228 - 16268266
Alignment:
| Q |
26 |
gtgtgaaatgttcaaaactttatatactacactttgaag |
64 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
16268228 |
gtgtgaaatgttcaaaactttatatactgcactttgaag |
16268266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University