View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19874_high_36 (Length: 237)

Name: NF19874_high_36
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19874_high_36
NF19874_high_36
[»] chr2 (1 HSPs)
chr2 (1-217)||(16738640-16738856)


Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 16738640 - 16738856
Alignment:
1 ttatacccttttctatcggatggttcttggagagaccttcaattggcttgccataatcaaatttctagcacaagtttcacttggagcgtaggtttaaccc 100  Q
    |||||| |||||||||  |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16738640 ttatactcttttctattagatgtttcttggagagaccttcaattggcttgccataatcaaatttctagcacaagtttcacttggagcgtaggtttaaccc 16738739  T
101 acttcttctctgatggataatgacacaatttatctttgcttatgtgatactttgatcggtccagtgtaggaattggtattgctttcgggattgcatctgt 200  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||    
16738740 acttcttctctgttggataatgacacaatttatctttgcttatgtgatactttgatcggtccagtgcaggaattggtattactttcgggattgcatctgt 16738839  T
201 tttatggcttgggttta 217  Q
    |||||||||||||||||    
16738840 tttatggcttgggttta 16738856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University