View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19874_high_49 (Length: 206)
Name: NF19874_high_49
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19874_high_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 181
Target Start/End: Original strand, 2260313 - 2260477
Alignment:
| Q |
17 |
gaacaaccgtgctgggtgggtgcctatactccctctttattcgtgctttctttattggtacgaattcgtgcaattttagtgtatgtttgatattaaggtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
2260313 |
gaacaaccgtgctgggtgggtgcctatactccctctttattcgtgcattctttattggtacgaattcatgcaattttagtgtatgtttgatattaaggtg |
2260412 |
T |
 |
| Q |
117 |
gatacgcaagaatcaccgtgattttgtagaaggtacaaattgtagtttcagaaaactcacagtgg |
181 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
2260413 |
gatacgcaagaatcaccgtaattttgtagaaggtacaaattgtagtttctgaaaaatcacagtgg |
2260477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 126 - 183
Target Start/End: Complemental strand, 36322770 - 36322713
Alignment:
| Q |
126 |
gaatcaccgtgattttgtagaaggtacaaattgtagtttcagaaaactcacagtgggt |
183 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||| ||||| |||| |||||| |
|
|
| T |
36322770 |
gaatcaccgtgattttgtagaagctacaaagtgtagtttttgaaaaatcacggtgggt |
36322713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University