View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19874_low_21 (Length: 308)
Name: NF19874_low_21
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19874_low_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 18 - 151
Target Start/End: Original strand, 33714786 - 33714919
Alignment:
| Q |
18 |
tatgccatgcaaagcaacagcctcaaacaatttcacttttggcttcttcctagtctaacaaagaacttaacctactttgtgagtataaatatgaatacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33714786 |
tatgccatgcaaagcaacagcctcaaacaatttcacttctggcttcttcctagtctaacaaagaacttaacctacttcgtgagtataaatatgaatacaa |
33714885 |
T |
|
| Q |
118 |
gatagaaaaataggaacagaagatcataaatcca |
151 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
33714886 |
gatagaaaaatagggacagaagatcataaatcca |
33714919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University