View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19874_low_29 (Length: 269)

Name: NF19874_low_29
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19874_low_29
NF19874_low_29
[»] chr2 (2 HSPs)
chr2 (80-140)||(16268278-16268338)
chr2 (26-64)||(16268228-16268266)


Alignment Details
Target: chr2 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 80 - 140
Target Start/End: Original strand, 16268278 - 16268338
Alignment:
80 ccacattatttgaaacatattaaatcacaaatttttgttcataaatactcttttcgatctt 140  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||    
16268278 ccacattatttgaaacatattaaatcacaattttttgttcataaatactctcttcgatctt 16268338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 26 - 64
Target Start/End: Original strand, 16268228 - 16268266
Alignment:
26 gtgtgaaatgttcaaaactttatatactacactttgaag 64  Q
    |||||||||||||||||||||||||||| ||||||||||    
16268228 gtgtgaaatgttcaaaactttatatactgcactttgaag 16268266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University