View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19874_low_37 (Length: 239)
Name: NF19874_low_37
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19874_low_37 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 95 - 222
Target Start/End: Original strand, 12867571 - 12867698
Alignment:
| Q |
95 |
atataaaagtgttgaaaacttttggtgtcgacaataaattctgcgattagattcaagtcattatggaatcggcttctctttcaatttatgtcaatgacac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12867571 |
atataaaagtgttgaaaacttttggtgtcaacaataaattctgcgattagattcaagtcattatggaatcggcttctctttcaatttatgtcaatgacac |
12867670 |
T |
|
| Q |
195 |
ttaacatggatatttcaagtgcaagaaa |
222 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
12867671 |
tcaacatggatatttcaagtgcaagaaa |
12867698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University