View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19874_low_39 (Length: 237)
Name: NF19874_low_39
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19874_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 16738640 - 16738856
Alignment:
| Q |
1 |
ttatacccttttctatcggatggttcttggagagaccttcaattggcttgccataatcaaatttctagcacaagtttcacttggagcgtaggtttaaccc |
100 |
Q |
| |
|
|||||| ||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16738640 |
ttatactcttttctattagatgtttcttggagagaccttcaattggcttgccataatcaaatttctagcacaagtttcacttggagcgtaggtttaaccc |
16738739 |
T |
 |
| Q |
101 |
acttcttctctgatggataatgacacaatttatctttgcttatgtgatactttgatcggtccagtgtaggaattggtattgctttcgggattgcatctgt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
16738740 |
acttcttctctgttggataatgacacaatttatctttgcttatgtgatactttgatcggtccagtgcaggaattggtattactttcgggattgcatctgt |
16738839 |
T |
 |
| Q |
201 |
tttatggcttgggttta |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
16738840 |
tttatggcttgggttta |
16738856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University