View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19874_low_41 (Length: 236)
Name: NF19874_low_41
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19874_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 40122059 - 40121845
Alignment:
| Q |
1 |
cagtatcgctttcacagcctcgcgttgctttgcacttgcagtgcagtacacaactactcctctatagtcttgttcttttctatttgcnnnnnnnnngtac |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40122059 |
cagtattgctttcacagcctcgcgttgctttgcacttgcagtgcagtacacaactactcctctatagtcttgttcttttctatttgc-ttttttttgtac |
40121961 |
T |
 |
| Q |
101 |
gtaaatacttccaaaattgattcatagcaagatttttctttagtattttaaaaaattcaggttnnnnnnnnntagcaattaattctaattgataatgaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
40121960 |
gtaaatacttccaaaattgattcatagcaagatttttctttagtattttaaaaaattcaggtt-aaaaaaaatagcaattaattctaattgataatgaat |
40121862 |
T |
 |
| Q |
201 |
ttttattttgtgatggt |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40121861 |
ttttattttgtgatggt |
40121845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University