View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19874_low_49 (Length: 218)

Name: NF19874_low_49
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19874_low_49
NF19874_low_49
[»] chr1 (1 HSPs)
chr1 (1-200)||(26528382-26528581)


Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 26528382 - 26528581
Alignment:
1 attgtggaaagaagtggaatctaacactattgatatgatgatagaagaggatttctctagagaggaaattgggtggaagaaaaatgctgaggaaacaaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26528382 attgtggaaagaagtggaatctaacactattgatatgatgatagaagaggatttctctagagaggaaattgggtggaagaaaaatgctgaggaaacaaaa 26528481  T
101 gagctagctggagaggttgaacttgctatattttgtttacttgttgatgaattttcagaggaattagtatgttaatgtgggtaaatttggatgcagttga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26528482 gagctagctggagaggttgaacttgctatattttgtttacttgttgatgaattttcagaggaattagtatgttaatgtgggtaaatttggatgcagttga 26528581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University