View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19874_low_50 (Length: 218)
Name: NF19874_low_50
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19874_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 22 - 208
Target Start/End: Complemental strand, 2670632 - 2670446
Alignment:
| Q |
22 |
caagaacaatctttaaggcacttgttttcacattccaacaatgtcatactcttgttcacaaacacacttctagtttctggcaattgcacattcttcaaat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2670632 |
caagaacaatctttaaggcacttgttttcacattccaacaatgtcatactcttgttcacaaacacacttctagtttctggcaattgcacattcttcaaat |
2670533 |
T |
 |
| Q |
122 |
gcaagaacttatctttgtcacattccaattctgtttttctcacacacccatctgagaaatttctcaaatcccattgcctttgcttct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2670532 |
gcaagaacttatctttgtcacattccaattctgtttttctcacacacccatctgagaaatttctcaaatcccattgcctttgattct |
2670446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University