View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19874_low_51 (Length: 210)
Name: NF19874_low_51
Description: NF19874
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19874_low_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 12 - 200
Target Start/End: Complemental strand, 42805138 - 42804950
Alignment:
| Q |
12 |
cacagacacgaagcaatggaaattcacataatgattggaacatcgaggtgactgatggtgtaaccgaacgaagacgattgaaaatgaagacgatcccgtt |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42805138 |
cacatacacgaagcaatggaaattcacatgatgattggaacatcgaggtgactgatggtgtaaccgaatgaagacgattgaaaatgaagacgatcccgtt |
42805039 |
T |
 |
| Q |
112 |
gagaagcataatcttctagcaaaattcgagcatcccagaaaacgtagaagactgaggagatgaataacaagaagtatgatgttattggt |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42805038 |
gagaagcataatcttctagcaagattcgagcatcccagaaaacgtagaagactgaggagatgaataacaagaagtatgatgttattggt |
42804950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University