View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19875_high_11 (Length: 250)
Name: NF19875_high_11
Description: NF19875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19875_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 43708381 - 43708620
Alignment:
| Q |
1 |
ccaatgatttgaagtcaaagtggataatgtgtcttaaaatgagtgnnnnnnnnn-----cttccagcttaagtagtatgtgaactgaataaggcagctgg |
95 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43708381 |
ccaatgatttgaagtcaaggtggataatgtgtcttaaaatgagttttttttctttctttcttccagcttaagtagtatgtgaactgaataaggcagctgg |
43708480 |
T |
|
| Q |
96 |
gtgattcaaatctttgtgtttttatcattctatcatctgccaatttgagatctactaatgccgtttacatatttgcactattatatttctgtgttttgtt |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43708481 |
gtgattcaaatctttgtgtttttatcattctatcatctgccaatttgagatctactaatgccgtttacatatttgcactattatatttctgtgttttgtt |
43708580 |
T |
|
| Q |
196 |
ggtatttttagtcaatttcaattttgcgtttcaaatgtat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43708581 |
ggtatttttagtcaatttcaattttgcgtttcaaatgtat |
43708620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University