View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19875_high_12 (Length: 241)
Name: NF19875_high_12
Description: NF19875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19875_high_12 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 25495073 - 25494833
Alignment:
| Q |
1 |
ttgaatcctctatttgggcaatcgttgctggttggcctgcatggataggtattggtggtgatgaagatcatcaagaatctgaaatcctaactggtaagtt |
100 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25495073 |
ttgaatcctctatttgggctatagttgctggttggcctgcatggataggtattggtggtgatgaagatcatcaagaatctgaaatcctaactgggaagtt |
25494974 |
T |
|
| Q |
101 |
taacattcagaaacatggtttggggtacaagtttgtattttgtccaacctatactatcccacctggttcttgttatgatattgtgaagattgatgatgtg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25494973 |
taacattcagaaacatggtttggggtacaagtttgtattttgtccaacctatactatcccacctggttcttgttatgatattgtgaagattgatgatgtg |
25494874 |
T |
|
| Q |
201 |
aatggaagacgtttgatcattcctatggatgatgtctgtgc |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
25494873 |
aatggaagacgtttgatccttcctatggatgatgtcagtgc |
25494833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University