View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19875_low_17 (Length: 220)
Name: NF19875_low_17
Description: NF19875
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19875_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 7 - 203
Target Start/End: Original strand, 18133090 - 18133286
Alignment:
| Q |
7 |
tccaagaatatgggcagcaaccaagccgcagtctccttcctaaccaacctcgcccgtgccgctttcggcctcggcaccgccgcaaccgttgtcaacacct |
106 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18133090 |
tccaaaaaaatgggaagcaaccaagccgcagtctccttcctaaccaacctcgcccgtgccgctttcggcctcggcaccgccgcaaccgttgtcaacacct |
18133189 |
T |
 |
| Q |
107 |
ccctctacaccgtcgatggtggccaacgcgccgtcctcttcgaccgttttcgcggaatcctcgaccaatcaatcggtgaaggaacccatttcctcat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18133190 |
ccctctacaccgtcgatggtggccaacgcgccgtcctcttcgaccgttttcgcggaatcctcgaccaatcaatcggtgaaggaacccatttcctcat |
18133286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 70 - 203
Target Start/End: Complemental strand, 1385330 - 1385197
Alignment:
| Q |
70 |
ttcggcctcggcaccgccgcaaccgttgtcaacacctccctctacaccgtcgatggtggccaacgcgccgtcctcttcgaccgttttcgcggaatcctcg |
169 |
Q |
| |
|
||||| |||||| |||||||||||| |||||| |||| |||||||||||||| ||||||||||||||||||||||| ||| | || ||||| ||||| |
|
|
| T |
1385330 |
ttcggtctcggcgccgccgcaaccgccgtcaactcctctctctacaccgtcgacggtggccaacgcgccgtcctctttgacagattccgcggcatccttt |
1385231 |
T |
 |
| Q |
170 |
accaatcaatcggtgaaggaacccatttcctcat |
203 |
Q |
| |
|
| ||||| ||||||||||||| ||||||||||| |
|
|
| T |
1385230 |
ccgaatcagtcggtgaaggaactcatttcctcat |
1385197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University