View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19877_high_15 (Length: 216)
Name: NF19877_high_15
Description: NF19877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19877_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 14 - 65
Target Start/End: Original strand, 33269247 - 33269298
Alignment:
| Q |
14 |
ataatactgatttctatgttgcttttcttgatgtttggattttttaactcat |
65 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
33269247 |
ataatgctgatttctatgttgcttttcttgatgtttggactttttaactcat |
33269298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 144 - 198
Target Start/End: Original strand, 33269297 - 33269355
Alignment:
| Q |
144 |
atggttgatcaagcacagaaa----gttaatctctatctgcttgcattgcagtgatacc |
198 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||| ||||||||||||||||||| |
|
|
| T |
33269297 |
atggttgattaagcacagaaatgttgttaatctatatctacttgcattgcagtgatacc |
33269355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University