View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19877_low_13 (Length: 239)

Name: NF19877_low_13
Description: NF19877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19877_low_13
NF19877_low_13
[»] chr1 (1 HSPs)
chr1 (1-221)||(6101225-6101445)


Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 6101445 - 6101225
Alignment:
1 tgagtttcgcggccgtaatcgtaggagaggaatgcgacggaggcgacaacggcggtggagagagcgacgatggaggttttggagaggaatgaggaagggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6101445 tgagtttcgcggccgtaatcgtaggagaggaatgcgacggaggcgacaacggcggtggagagagcgacgatggaggttttggagaggaatgaggaagggg 6101346  T
101 ttacaggagagagtttgttaggaacggttggaggggtaatttggggattttgtgaaattttctccggtgaatgtgaattggaagatgatgaagaagaaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6101345 ttacaggagagagtttgttaggaacggttggaggggtaatttggggattttgtgaaattttctccggtgaatgtgaattggaagatgatgaagaagaaat 6101246  T
201 gtagtatttgtagggattagg 221  Q
    |||||||||||||||||||||    
6101245 gtagtatttgtagggattagg 6101225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University