View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19877_low_14 (Length: 224)
Name: NF19877_low_14
Description: NF19877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19877_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 13 - 206
Target Start/End: Complemental strand, 34604447 - 34604249
Alignment:
| Q |
13 |
gagatgaataaataggagaggcaagttattgctagtgattgaggactagt---gaatgggaaatgcatttattggaattatttgtgcataaaagaggttt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34604447 |
gagatgaataaataggagaggcaagttattgctagtgattgaggactagtagtgaatgggaaatgcatttattggaattatttgtgcataaaagaggttt |
34604348 |
T |
 |
| Q |
110 |
catgcaatgcaagcaatatgtga--ttaaactttttaggaaagattattagcaagataaagtttatatagtgatggagaccaaggattccgtggggtag |
206 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34604347 |
catgcaatgcaagcaatatgtgagattaaactttttaggaaagattattagcaagataaagtttatatagtgatggagaccaaggattccgtggggtag |
34604249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University