View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19877_low_15 (Length: 222)

Name: NF19877_low_15
Description: NF19877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19877_low_15
NF19877_low_15
[»] chr5 (1 HSPs)
chr5 (13-208)||(16281243-16281437)


Alignment Details
Target: chr5 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 13 - 208
Target Start/End: Complemental strand, 16281437 - 16281243
Alignment:
13 aacctgtgatcaaatatccccacaactttttactatttaaaattgcacttatgatgaaaccatgaatggacatctattccagtttaccctttttatatac 112  Q
    ||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16281437 aacctatgatcaaatatccccacaactttttactatttaaa-ttgcacttatgatgaaaccatgaatggacatctattccagtttaccctttttatatac 16281339  T
113 ttgtacaaaccctttttactatttaacaagcatacgaaagaaatactagatacattgcacattatgtgtatatgagagtccaatctgggttcttag 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
16281338 ttgtacaaaccctttttactatttaacaagcatacgaaagaaatactagatacattgcacattatgtgtgtatgagagtccaatctgggttcttag 16281243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University