View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19877_low_16 (Length: 216)

Name: NF19877_low_16
Description: NF19877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19877_low_16
NF19877_low_16
[»] chr7 (2 HSPs)
chr7 (14-65)||(33269247-33269298)
chr7 (144-198)||(33269297-33269355)


Alignment Details
Target: chr7 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 14 - 65
Target Start/End: Original strand, 33269247 - 33269298
Alignment:
14 ataatactgatttctatgttgcttttcttgatgtttggattttttaactcat 65  Q
    ||||| ||||||||||||||||||||||||||||||||| ||||||||||||    
33269247 ataatgctgatttctatgttgcttttcttgatgtttggactttttaactcat 33269298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 144 - 198
Target Start/End: Original strand, 33269297 - 33269355
Alignment:
144 atggttgatcaagcacagaaa----gttaatctctatctgcttgcattgcagtgatacc 198  Q
    ||||||||| |||||||||||    |||||||| ||||| |||||||||||||||||||    
33269297 atggttgattaagcacagaaatgttgttaatctatatctacttgcattgcagtgatacc 33269355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University