View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_high_101 (Length: 254)
Name: NF19878_high_101
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_high_101 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 244
Target Start/End: Complemental strand, 46797794 - 46797569
Alignment:
| Q |
19 |
aaaatgaaaatgcaattttttctgactgagttggtatatttgcggttgagttttatacagaggagacaggtaagcagctattacagcctctcacctacct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46797794 |
aaaatgaaaatgcaattttttctgactgagttggtatatttgcggttgagttttatacagaggagacaggtaagcagctattacagcctctcacctacct |
46797695 |
T |
 |
| Q |
119 |
tttacactctttgtacggtttcaaacttcattttctttcggataaaaaccttcatagctagatccataaggatagggttttcaactttttcaggtgtata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46797694 |
tttacactctttgtacggtttcaaacttcattttctttcggataaaaaccctcatagctagatccataaggatagggttttcaactttttcaggtgtata |
46797595 |
T |
 |
| Q |
219 |
taactactacaatttcctttgctact |
244 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
46797594 |
taactactacaatttcctttgttact |
46797569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University