View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_high_103 (Length: 252)
Name: NF19878_high_103
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_high_103 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 6 - 100
Target Start/End: Complemental strand, 9692714 - 9692620
Alignment:
| Q |
6 |
atatgtctcgagcataccttccatgatgaactagaaatccttgtgcttttatcttaaattccatttctatgaaataagataagataccaagatca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692714 |
atatgtctcgagcataccttccatgatgaactagaaatccttgtgctcttatcttaaattccatttctatgaaataagataagataccaagatca |
9692620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 152 - 236
Target Start/End: Complemental strand, 9692622 - 9692539
Alignment:
| Q |
152 |
tcattgttgccggtcacaatcatgtcaccaacatatttagcttacaattagtttgtgcttatttgttgagtttttgcagtataag |
236 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692622 |
tcattgttgccggtcacaatcacgtcaccaacatatt-agcttacaattagtttgtgcttatttgttgagtttttgcagtataag |
9692539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University