View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_high_109 (Length: 250)
Name: NF19878_high_109
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_high_109 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 8600779 - 8600581
Alignment:
| Q |
1 |
agctgatttcagattgtgaatgaaatacactgaaatatttataaaatagtagaatattaaccatttttattaacaatttactttccgaaat-gaaaactt |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |||||||| |
|
|
| T |
8600779 |
agctgatttcagattgagaatgaaatacactgaaatctttataaaatagtagaatattaaccatttttattaacgatttactttccaaaattgaaaactt |
8600680 |
T |
 |
| Q |
100 |
tatgttgagggaaccattatttcacagaaccgaaccatcatgacttctatcctgtagcatatttatacaaattttgtaatcaaaatgttttttcttagc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
8600679 |
tatgttgagggaaccattatttcacagaaccgaaccatcatgacttctatcctgtagcatgtttatacaaattttgcaatcaaaatgttttttcttagc |
8600581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University