View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_high_119 (Length: 234)
Name: NF19878_high_119
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_high_119 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 19856361 - 19856581
Alignment:
| Q |
1 |
tcttaatgcttccttcacaatgcattgcaagtaacacattttttgaacatcagcatcattgataactttggaatttccaacaacacggtaaatttcttct |
100 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19856361 |
tcttaatgcttccttcacaatgcactgtaagtaacacattttttgaacatcagcatcagtgataactttggaatttccaacaacacggtaaatttcttct |
19856460 |
T |
|
| Q |
101 |
tgtacttttgcttgtatctctggatgaagcaccattctagccaaaatccattctagtaatattgctactgtgtctgttcctctgaaaatcatttcctaaa |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19856461 |
tgtgcttttgcttgtatctctggatgaagcaccatcctagccagaatccattctagtaatattgctactgtgtctgttcctctgaaaatcatttcctaaa |
19856560 |
T |
|
| Q |
201 |
agaagacaaaaatcaaacaac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19856561 |
agaagacaaaaatcaaacaac |
19856581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University