View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_high_128 (Length: 222)
Name: NF19878_high_128
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_high_128 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 51 - 202
Target Start/End: Complemental strand, 3681222 - 3681071
Alignment:
| Q |
51 |
taatgaatctaagcaaaagctggtaggtaatctattatagaggtatatcggtcccactgtgataaatgaagggatgaaactaaaattaataagttacgtt |
150 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3681222 |
taataaatctaagcaaaagctagtaggtaatctattatagaggtatatcggtcccactgtgataaatgaaaggatgaaactaaaattaataagttacgtt |
3681123 |
T |
|
| Q |
151 |
cccctcgcgttgctaatccaaagtttgaagattgcgaagatgactctttaaa |
202 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3681122 |
tccctcgcgttgttagtccaaagtttgaagattgcgaagatgactctttaaa |
3681071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University