View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_high_133 (Length: 205)
Name: NF19878_high_133
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_high_133 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 45 - 187
Target Start/End: Complemental strand, 15527570 - 15527424
Alignment:
| Q |
45 |
gaaacagctaagaaaacatttcttttcttcggttgtgtaatgctggatttaatatcatttcgtttgcctttttactcccttaggtaggtgcttatttgaa |
144 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
15527570 |
gaaacagctaagaaaacatttctttttctccgttgtgtaatgctggatttaatttcattcggtttgcctttttactcccttaggtagatgcttatttgaa |
15527471 |
T |
 |
| Q |
145 |
taaattctaaccagtt----gatgaaatgatgattcaacacataaca |
187 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
15527470 |
taaattctaaccagttgatcgatgaaatgacgattcaacacataaca |
15527424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University