View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_high_14 (Length: 558)
Name: NF19878_high_14
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_high_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 11 - 307
Target Start/End: Complemental strand, 9693039 - 9692743
Alignment:
| Q |
11 |
agaaaatggaatcatatttctatataattgatccttccatgagcaattggatgctttgtaagctcaatagctgatctattgctcaccaataatctcatct |
110 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9693039 |
agaaaatggaatcatatttctatatatttgatccttccatgagcaattggatgctttgcaagctcaatagctgatctattgctcaccaataatctcatct |
9692940 |
T |
 |
| Q |
111 |
tcttatctttattcaaattcatctcttgcatcgacatgcttaaccattatatgcaaccactgaagatgcaatgtactctacctcacaggagtataaagct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9692939 |
tcttatctttattcaaattcatctcttgcatcaacatgcttaaccattatatgcaaccactgaagatgcaatgtactctacctcacaagagtataaagct |
9692840 |
T |
 |
| Q |
211 |
ataacatattccttatttgagcaccatgacattgtttcattcccataaatgaacacatatacaacaatgttttttctatcacttttgtctctgctca |
307 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9692839 |
ataacacatttcttatttgagcaccatgacattgtttcattcccataaatgaacacatatacaacaatgttttttctatcacttttgtctctgctca |
9692743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 518 - 558
Target Start/End: Complemental strand, 9692714 - 9692674
Alignment:
| Q |
518 |
atatgtctcgagcatacgttccatgatgaactagaaatcct |
558 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9692714 |
atatgtctcgagcataccttccatgatgaactagaaatcct |
9692674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University