View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_high_50 (Length: 397)
Name: NF19878_high_50
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_high_50 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 1e-63; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 177 - 304
Target Start/End: Original strand, 53145631 - 53145758
Alignment:
| Q |
177 |
gaatgaatgtgataaaggacgtgagatttgttttgatagaactgtactagtgtttcaattggttaccaaaattttggacaattttgcatttattttcatt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53145631 |
gaatgaatgtgataaaggacgtgagatttgttttgatagaactgtacaagtgtttcaattggttaccaaaattttggacaattttgcatttattttcatt |
53145730 |
T |
|
| Q |
277 |
tgaagaaaagttaaccacataatttaca |
304 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
53145731 |
tgaagaaaagttaaccacataatttaca |
53145758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 19 - 106
Target Start/End: Original strand, 53145534 - 53145621
Alignment:
| Q |
19 |
atgaagtaagctgaaaacgatgtgttttcttgatttttcttctttcgacaaaaatgagnnnnnnngaccggctgtggccgaaggtagt |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| || |||||||||||||||| |
|
|
| T |
53145534 |
atgaagtaagctgaaaacgatgtgttttcttgattttttttctttcgacaaaaatgagtttttttgactggttgtggccgaaggtagt |
53145621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 53145146 - 53145199
Alignment:
| Q |
18 |
gatgaagtaagctgaaaacgatgtgttttcttgatttttcttctttcgacaaaa |
71 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
53145146 |
gatgaagtaagctgaaaatgatgtgttttcttgatttttcttctttcgacaaaa |
53145199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University