View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_high_53 (Length: 382)
Name: NF19878_high_53
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_high_53 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 1 - 372
Target Start/End: Complemental strand, 53460438 - 53460067
Alignment:
| Q |
1 |
gataacgagtacattgcattcctttccttagcctgatttcttcgtgagggaaaggatgttatattaagtaaacattttgacttggctttatgaattttgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53460438 |
gataacgagtacattgcattcctttccttagcctgatttcttcgtgagggaaaggatattatattaagtaaacattttgacttggctttatgaattttgc |
53460339 |
T |
|
| Q |
101 |
actgacttatatgacactctttcaaagagtcaagattacctttcaaatgcaggttgccttctttgacttctacaattatggttgaatgctatttatgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53460338 |
actgacttatatgacactctttcaaagagtcaagattacctttcaaatgcaggttgccttctttgacttctacaattatggttgaatgctatttatgttt |
53460239 |
T |
|
| Q |
201 |
caagttttcaagatatcaatatctctctaccttttggaactccttatcatggtaaacttgcacacttgacaaagttagtgaccctttctgattcgatgtc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
53460238 |
caagttttcaagatatcaatatctctctacctattggaactccttatcatggtaaacttgcacgcttgacaaagttcgtgaccctttctgattcgatgtc |
53460139 |
T |
|
| Q |
301 |
ttcctttatgcaacattttgaatggttttgtactcttaaacagcaccattcttatttcttgtttatcctatg |
372 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53460138 |
ttcctttatgcaacatttcgaatggttttgtactcttaaacaacaccattcttatttcttgtttatcctatg |
53460067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University