View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_high_79 (Length: 317)
Name: NF19878_high_79
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_high_79 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 43 - 269
Target Start/End: Original strand, 42358859 - 42359088
Alignment:
| Q |
43 |
atttgatatgcatataatttaat-taattaat--atattgtggtgcaggtcattttgtgttgacaaaaatgttgatgaagaagatggttgaaacggcaaa |
139 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358859 |
atttgatatgcatataatataatataattaattaatattgtggtgcaggtcattttgtgttgacaaaaatgttgatgaagaagatggttgaaacggcaaa |
42358958 |
T |
 |
| Q |
140 |
ggagacagggatagaaggaaggatagtgaacgtgtcgtccgcaatacacggttggtttactggcgacgtcatctcctatttggctcatatatgccgcaac |
239 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42358959 |
ggagacagggattgaaggaaggatagtgaacgtgtcgtccgcaatacacggttggtttactggcgacgtcatctcctatttggctcatatatgccgcaac |
42359058 |
T |
 |
| Q |
240 |
aaaaggtgacaaataactactattatctta |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42359059 |
aaaaggtgacaaataactactattatctta |
42359088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 42358811 - 42358844
Alignment:
| Q |
1 |
ccactaattatttaggtgagtaagattacaacaa |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42358811 |
ccactaattatttaggtgagtaagattacaacaa |
42358844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University