View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_low_111 (Length: 250)
Name: NF19878_low_111
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_low_111 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 43104525 - 43104764
Alignment:
| Q |
13 |
aaaatatagatctataattcataatataaagcataattatctacaaggtgatttaa--taggttttctttaaggaaagtgatttaatagataaatatgaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43104525 |
aaaatatagatctataattcataatataaagcataattatctacaaggtgatttaaaataggttttctttaaggaaagtgatttaatagataaatatgaa |
43104624 |
T |
|
| Q |
111 |
tataatagtattatatggtcataaatagatttagagatagtgcaattgccttgcacatatttggtggacaaaggttacatccatgagaagattttagata |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43104625 |
tataatagtattatatggtcataaatagatttagagatagtgcaattgccttgcacatatttggtggacaaaggttacatccatgagaagattttagata |
43104724 |
T |
|
| Q |
211 |
atcatggtagggacaaattatgagcctcccttctccatta |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43104725 |
atcatggtagggacaaattatgagcctcccttctccatta |
43104764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University