View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_low_119 (Length: 239)
Name: NF19878_low_119
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_low_119 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 3322897 - 3323116
Alignment:
| Q |
19 |
atggtgatgtgtctgtgcttgttgtttcatcatcactactattgtattggtgcattgtctcattttctttgaatgtgtttaagtcactttcatttttgtg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3322897 |
atggtgatgtgtctgtgcttgttgtttcatcatcactactattgtattggtgcattgtctcattttctttgaatgtgttcaagtcactttcatttttgtg |
3322996 |
T |
 |
| Q |
119 |
ttctcctcctccacttccacccgactgcgtccccttttaatgaataagtcgtcaatatagtctctaaaataataggataagacaatttaagtatgactta |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||| ||| |
|
|
| T |
3322997 |
ttctcctcctccacttccacccaactgcgtccccttttaatgaataagtcgtcaatttagtctctataataataggatcagacaatttaagtatgattta |
3323096 |
T |
 |
| Q |
219 |
tatttagttttggtgtcacc |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3323097 |
tatttagttttggtgtcacc |
3323116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University