View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_low_120 (Length: 237)
Name: NF19878_low_120
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_low_120 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 145 - 220
Target Start/End: Original strand, 41963343 - 41963418
Alignment:
| Q |
145 |
atgaaatggaaaggtgtgagaaaaggggtgtcgaagaattttcaaactgggtttgttgcttgtcctagggagttta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41963343 |
atgaaatggaaaggtgtgagaaaaggggtgtcgaagaattttcaaactgggtttgttgcttgtcctagggagttta |
41963418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 41963181 - 41963234
Alignment:
| Q |
1 |
gtaagtaccgggaatgaggtaaaagtctgtgggtcgcgttcttctttttcttcg |
54 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
41963181 |
gtaagtaccgggaatgaggtaaaagttcgtgggtcgcgttctactttttcttcg |
41963234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 145 - 220
Target Start/End: Original strand, 1224799 - 1224874
Alignment:
| Q |
145 |
atgaaatggaaaggtgtgagaaaaggggtgtcgaagaattttcaaactgggtttgttgcttgtcctagggagttta |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1224799 |
atgaaatggaaaggtgtgagaaaaggggtgtcgaagaattttcaaactgggtttgttgcttgtcctagggagttta |
1224874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 1224655 - 1224722
Alignment:
| Q |
1 |
gtaagtaccgggaatgaggtaaaagtctgtgggtcgcgttcttctttttcttcgtcttcgaagaaaaa |
68 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1224655 |
gtaagtaccgggaatgaggtaaaagttcgtgggtcgcgttcttctttttcttcgtcttcgaagaaaaa |
1224722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University