View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_low_15 (Length: 554)
Name: NF19878_low_15
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 284; Significance: 1e-159; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 210 - 535
Target Start/End: Complemental strand, 8903751 - 8903420
Alignment:
| Q |
210 |
catcacaattacctttgaagaagttcaggtttattgagcaacccggatccgatgtaaatggggtagctccgattacccaaatcaacgttaacaatggtgg |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8903751 |
catcacaattacctttgaagaagttcaggtttattgagcaacccggatccgatgtaaatggggtagctccgattacccaaatcaacgttaacaatggtgg |
8903652 |
T |
|
| Q |
310 |
gaacaccaggttggatttttgctgaaaaggggtccatgagttgagaggaactagcgcatattggtgacctaagaggtgtagaaagagagannnnnnnagg |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8903651 |
gaacaccaggttggatttttgctgaaaaggggtccatgagttgagaggaactagcgcatattggtgacctaagaggtgtagaaagagagatttttttagg |
8903552 |
T |
|
| Q |
410 |
aaaaaggttggtggggtgaggggagaaagagtgggggtgtagaaagttaggattttgaagggaggagaggtgaattggttgttgtttgagggaggg---- |
505 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8903551 |
aaaaaggttggtggagtgaggggagaaagagtgggggtgtagaaagttaggattttgaagggaggagaggtgaattggttgttgtttgagggagggggag |
8903452 |
T |
|
| Q |
506 |
--ggagatggagaattgggtgggtgtggaagc |
535 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8903451 |
atggagatggagaattgggtgggtgtggaagc |
8903420 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 51 - 163
Target Start/End: Complemental strand, 8903910 - 8903798
Alignment:
| Q |
51 |
ttggatacatacttaaaagtatacaacttaatccttaattgaaaattgataacgtgaaattgcttgcaactgtaagtctgtcactactaatttactaatc |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8903910 |
ttggatacatacttaaaagtatacaacttaaaccttaattgaaaattgataacgtgaaattgcttgcaactgtaagtctgtcactaccaatttactaatc |
8903811 |
T |
|
| Q |
151 |
atgaaacataggc |
163 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8903810 |
atgaaacataggc |
8903798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 8903960 - 8903929
Alignment:
| Q |
1 |
ggtgcaatttaattggatacatactttctttc |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8903960 |
ggtgcaatttaattggatacatactttctttc |
8903929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University