View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_low_48 (Length: 410)
Name: NF19878_low_48
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_low_48 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 381; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 381; E-Value: 0
Query Start/End: Original strand, 1 - 397
Target Start/End: Original strand, 471183 - 471579
Alignment:
| Q |
1 |
tgaaaatgagagtgataaatctatgaaagcaaagttgctttttagagtgattgctacatttttggttatggctttagcatttcttttgtttgaacttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
471183 |
tgaaaatgagagtgataaatctatgaaagcaaagttgctttttagagtgattgctacatttttggttatggctttagcatttcttttgtttgaacttgtt |
471282 |
T |
|
| Q |
101 |
actcatttcaaagggttgtgctattttcataatcataatttgcacattccacaaaattgggagattaaagggttgtttcatgaggtttatgttagttggt |
200 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
471283 |
gctcatttcaaagggttgtactattttcataatcataatttgcacattccacaaaattgggagattaaagggttgtttcatgaggtttatgttagttggt |
471382 |
T |
|
| Q |
201 |
tgaggtttagagttgattatattgcatcaacaattcaatatctttcaaatttctgcatagttttgttcttgattcagtctgtggatagaatggttttgtg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
471383 |
tgaggtttagagttgattatattgcatcaacaattcaatatctttcaaatttctgcatagttttgttcttgattcagtctgtggatagaatggttttgtg |
471482 |
T |
|
| Q |
301 |
tattggttgcttttggatcaagtacaaaaagattaaacctttgattgttgatggaaatgttgaagatgatttggaaggttccaaccatggctttcct |
397 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
471483 |
tcttggttgcttttggatcaagtacaaaaagattaaacctttgattgctgatggaaatgttgaagatgatttggaaggttccaaccatggctttcct |
471579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University