View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_low_61 (Length: 372)
Name: NF19878_low_61
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 19 - 132
Target Start/End: Complemental strand, 2954425 - 2954314
Alignment:
| Q |
19 |
atttaaccatctctttatactagtcctccaaatccaatatccaagaactctcaaaacggaagggtctcggtattggaaattgtattacatcactagtgtg |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2954425 |
atttaaccatctcttcatactagtcctccaaatccaatatccaagaactctcaaaacggaagggtctcggtattggaaattgtattacatcact--tgtg |
2954328 |
T |
 |
| Q |
119 |
gcctttatccctcg |
132 |
Q |
| |
|
| |||||| ||||| |
|
|
| T |
2954327 |
ggctttatacctcg |
2954314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 291 - 327
Target Start/End: Original strand, 19407005 - 19407041
Alignment:
| Q |
291 |
tcttgcatgtgatcgacttgtcttattgcatgagatg |
327 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19407005 |
tcttgcatgtgatacacttgtcttattgcatgagatg |
19407041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University