View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_low_62 (Length: 366)
Name: NF19878_low_62
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_low_62 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 19 - 309
Target Start/End: Original strand, 2389451 - 2389741
Alignment:
| Q |
19 |
atatcagatatggagaaatatgtatgaaatgcaaaggagaaactgaaaggcttgccattgacattccggatgcgagatatcatattcagacggccatctg |
118 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389451 |
atatcggatatcgagaaatatgtatgaaatgcaaaggagaaactgaaaggcttgccattgacattccggatgcgagatatcatattcagacggccatctg |
2389550 |
T |
 |
| Q |
119 |
ctgccaaacagacccttaggcgaaactcgaagctgaataaaataatttagtacataaaacattgttatccaacaatctcaattctcaagatacatgaaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2389551 |
ctgccaaacagacccttaggcgaaactcgaagctgaataaaataatttagtacataaaacattgtcatccaacaatctcaattctcaagatacatgaaat |
2389650 |
T |
 |
| Q |
219 |
atacatgttactgtataggaactggggtatctagctacatgcttctgcaatttctactctcttggatgcgattcatcaattgtcctttaat |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389651 |
atacatgttactgtataggaactggggtatctagctacatgcttctggaatttctactctcttggatgcgattcatcaattgtcctttaat |
2389741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University