View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_low_72 (Length: 348)
Name: NF19878_low_72
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_low_72 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 17 - 336
Target Start/End: Complemental strand, 53460761 - 53460439
Alignment:
| Q |
17 |
atatactatcttaaccacattaatactaaaaattccattagagcccagttaattatt---ttcattttgaaggaccaaaattatgcttttttaggaacnn |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53460761 |
atatactatcttaaccacattaatactaaaaattccattagagcctagttaattattcatttcattttgaaggaccaaaattatgcttttttaggaactt |
53460662 |
T |
 |
| Q |
114 |
nnnnnccttccaaccatctaaaacatgttgagtctttattcgccaatcatcattcattttcttttttggatttcaaaggccctatcaaccctagattttt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53460661 |
tttttccttccaaccatctaaaacatgttgagtctttattcgccaatcatcattcattttcttttttggatttcaaaggccctatcaaccctagattttt |
53460562 |
T |
 |
| Q |
214 |
tgagataactcacgatgcttttaggtctatgcttgataatgtcaatccctcaaagcaaacttaacttcttcaaggtatattcaattcatccaaaacaatc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53460561 |
tgagataactcacgatgcttttaggtctatgcttgataatgtcaatccctcaaagcaaacttaacttcttcaaggtatattcaattcatccaaaacaatc |
53460462 |
T |
 |
| Q |
314 |
aatcaaagcaaaaagatggttca |
336 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
53460461 |
aatcaaagcaaaaagatggttca |
53460439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University