View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_low_89 (Length: 302)
Name: NF19878_low_89
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_low_89 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 19 - 293
Target Start/End: Original strand, 14755803 - 14756077
Alignment:
| Q |
19 |
cttaaccttgagttcttataactatcaaagtcgaactcaactcaagccacttgtctctccaaaataagcaccacagacatacatatacatataaataaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14755803 |
cttaaccttgagttcttataactatcaaagtcgaactcaactcaagccacttgtctctccaaaataagcaccacagacatacatatacatataaataaaa |
14755902 |
T |
 |
| Q |
119 |
agtttttataacattgtaggcaccattccagcacacacaccatgcataattccaaatgcacaaccaaataagcctctaaattccaaccaaattacatgca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14755903 |
agtttttataacattgtaggcaccattccagcacacacaccatgcataattccaaatgcacaaccaaataagcctctaaattccaaccaaattacatgca |
14756002 |
T |
 |
| Q |
219 |
tgacctttcatgacagccaatcagcctgctgtgttggtgaaattacttcactgccctctcttgtcacccctatgc |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14756003 |
tgacctttcatgacagccaatcagcctgctgtgttggtgaaattacttcactgccctctcttgtcacccccatgc |
14756077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University