View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19878_low_92 (Length: 288)
Name: NF19878_low_92
Description: NF19878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19878_low_92 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 1 - 274
Target Start/End: Original strand, 23387014 - 23387291
Alignment:
| Q |
1 |
ttacaaccttgtactgtactttgaagctacctctcctataattgtggtatatattatgcaatactcttcannnnnnnnnnnnnnnnnnnnnnnnnaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23387014 |
ttacaaccttgtactgtactttgaagctgcctctcctataattgtggtatatattatgcaatactcttcactctctctctcttctttctctctctaaaat |
23387113 |
T |
|
| Q |
101 |
atttattgttcctccgcatatgtgcaggtgaatgccagcaattccccctcttatgcagc----cagatacagacttataatattctttcctctatctatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23387114 |
atttattgttcctccgcatatgtgcaagtgaatgccagcaattccccctcttatgcagccagccagatacagacttacaatattctttcctctatctatg |
23387213 |
T |
|
| Q |
197 |
ctattttttcttcttcttgggatagtttaaaaagtaggctcggacttggttaagacactagtttattgggttattggt |
274 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23387214 |
ctattttttcttcttctagggatggtttaaaaagtaggctcggacttggttaagacactagtttattgggttattggt |
23387291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University